【病毒外文文獻(xiàn)】2005 Identification and Antigenic Epitope Mapping of Immunodominant Region Amino Residues 510 to 672 on the Spike Protei

《【病毒外文文獻(xiàn)】2005 Identification and Antigenic Epitope Mapping of Immunodominant Region Amino Residues 510 to 672 on the Spike Protei》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2005 Identification and Antigenic Epitope Mapping of Immunodominant Region Amino Residues 510 to 672 on the Spike Protei（7頁珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

DNA AND CELL BIOLOGY Volume 24 Number 8 2005 Mary Ann Liebert Inc Pp 503 509 Identification and Antigenic Epitope Mapping of Immunodominant Region Amino Residues 510 to 672 on the Spike Protein of the Severe Acute Respiratory Syndrome Coronavirus RONG HONG HUA YUN FENG WANG ZHI GAO BU YAN JUN ZHOU JIN YING GE XI JUN WANG and GUANG ZHI TONG ABSTRACT The severe acute respiratory syndrome SARS is a newly emerging human infectious disease caused by the severe acute respiratory syndrome coronavirus SARS CoV The spike S protein of SARS CoV is a major virion structural protein It plays an important role in the interaction with receptors and neutralizing anti bodies In this study the S1 domain of the spike protein and three truncated fragments were expressed by fusion with GST in a pGEX 6p 1 vector Western blot results demonstrated that the 510 672 fragment of the S1 domain is a linear epitope dominant region To map the antigenic epitope of this linear epitope dominant region a set of 16 partially overlapping fragments spanning the fragment were fused with GST and expressed Four antigenic epitopes S1C3 539 559 S1C4 548 567 S1C7 8 583 606 and S1C10 11 607 630 were identified Immunization of mice with each of the four antigenic epitope fused proteins revealed that all four proteins could elicit spike protein specific antisera All of them were able to bind to the surface domain of the whole spike protein expressed by recombinant baculovirus in insect cells Identification of antigenic epitopes of the spike protein of SARS CoV may provide the basis for the development of immunity based prophylac tic therapeutic and diagnostic clinical techniques for the severe acute respiratory syndrome 503 INTRODUCTION T HE SEVERE ACUTE RESPIRATORY SYNDROME coronavirus SARS CoV is a newly emerged virus and has been iden tified to be the causative agent of the severe respiratory syn drome SARS Drosten et al 2003 Ksiazek et al 2003 Peiris et al 2003 SARS is a highly infectious and fatal disease Dur ing the epidemic of 2002 to 2003 this disease affected approx imately 8500 people worldwide and caused over 800 deaths SARS CoV is an enveloped positive sense ssRNA virus The genome of SARS CoV is approximately 29 7 kb in length with 11 open reading frames Its genomic organization is sim ilar to that of other coronaviruses Qin et al 2003 SARS CoV has four main structural proteins designated S M E and N Its gene sequence and amino acid sequence have very low homology with any other known animal coronaviruses Marra et al 2003 Qin et al 2003 Rota et al 2003 Recently how ever SARS CoV like viruses were isolated from Himalayan palm civets Guan et al 2003 which had not been found in any animal or human before 2003 Phylogenetic analysis indi cated that the new SARS CoV and SARS CoV like viruses are not related to the known group 1 2 or 3 coronaviruses but rather represent a novel type of coronavirus Eickmann et al 2003 Therefore it is proposed that they represent a fourth group within the genus Coronavirus the group 4 coronavirus The SARS CoV spike protein has 1255 amino acids It is a type 1 transmembrane glycoprotein Bosch et al 2003 Un like other coronavirus spike proteins SARS CoV spike protein was not cleaved into S1 and S2 domains But according to the conserved motifs alignment and functional analysis the SARS National Key Laboratory of Veterinary Biotechnology Harbin Veterinary Research Institute Chinese Academy of Agricultural Sciences Harbin People s Republic of China CoV spike protein can be divided into two domains S1 and S2 Li et al 2003 Spiga et al 2003 The S1 domain of the SARS CoV spike protein determines tropism to target cells and me diates binding with receptors on cells Li et al 2003 Wong et al 2004 The S2 domain has a transmembrane sequence and enables the spike protein to dock on the envelope membrane of the virus Like some other virus spike proteins SARS CoV spike protein has two conserved heptad repeat regions that me diate viral introduction via virus host cell membrane fusion Gallagher and Buchmeier 2001 Liu et al 2004 Tripet et al 2004 The spike protein has good antigenicity and may induce neutralizing antibodies An inactivated SARS coronavirus vac cine an attenuated virus vaccine a recombinant spike protein subunit vaccine and a spike protein encoding DNA vaccine each have the ability to induce protective neutralization anti bodies Bisht et al 2004 Bukreyev et al 2004 He et al 2004 Takasuka et al 2004 Xiong et al 2004 Yang et al 2004 These features make the SARS CoV spike protein a suit able candidate for genetic engineering of a subunit vaccine and suggest it may have diagnostic applications Epitope mapping is helpful for vaccine design and epitope based vaccines have great application prospects Linear neutral ization epitopes have been identified in other coronaviruses Daniel et al 1993 Recently some linear epitopes were identified in the SARS CoV spike protein Choy et al 2004 Hua et al 2004 Zhang et al 2004 Zhou et al 2004 In this study with a prokary otic expression system we identified four linear antigenic epitopes All four of these epitopes are on the exposed domain of the SARS CoV spike protein and therefore may be useful in the develop ment of effective vaccines against SARS CoV MATERIALS AND METHODS Expression of S1 and truncated S1 fragments of the SARS CoV spike protein The S1 12 672 amino acid aa of SARS CoV spike pro tein encoding fragment was PCR amplified with a pair of primers S1p1 and S1p2 by using the plasmid pBLUE SS as a template Table 1 The pBLUE SS plasmid harboring the full length SARS spike protein gene was previously constructed in our laboratory The SRBD 318 672 aa of SARS CoV spike protein encoding fragment was PCR amplified with another pair of primers Table 1 For SRBD amplification the forward primer was SRBDp1 and the reverse primer was SRBDp2 The N terminal fragment of S1 S1N was amplified with the S1p1 and SRBDp2 primers and the C terminal fragment S1C was amplified with the SRBDp1 and S1p2 primers The PCR products were digested with the restriction enzymes BamHI and XhoI recovered and then cloned into the pGEX 6p 1 plasmid Invitrogen Carlsbad CA The recombinant plas mids were identified by restriction enzyme digestion and se quencing The confirmed recombinant plasmid was transformed into Escherichia coli strain BL21 After induction with 0 1 M IPTG at 37 C for 4 h the recombinant fusion protein GST S1 was expressed in an inclusion body The inclusion body was denatured with 8 M urea and refolded in Tris HCl buffer Expression and purification of overlapping short fragments covering the 510 672 aa fragment A set of 16 partially overlapping short peptides S1C1 to S1C16 covering the fragment 510 to 672 aa were designed as shown in Figure 2A For each short peptide a pair of oligonu cleotide strands was synthesized After annealing the two strands the double stranded DNA formed a BamHI and an XhoI cohesive terminus at the 5H11032 and 3H11032 ends respectively The an nealed fragment was cloned into the expression vector pGEX 6p 1 The inserts in the recombinant plasmids were sequenced The confirmed recombinant plasmid was transformed into the E coli strain BL21 and the expressed short peptide with a GST tag was purified by Glutathione Sepharose 4B RediPack Col umn affinity chromatography according to the manufacturer s HUA ET AL 504 205 KD GST S1 GST S1N GST S1C GST SRBD GST 116 KD 97 4 KD 66 KD 45 KD 29 KD FIG 1 Western blot analysis of the reactivity of S1 and its truncated fragments with sera from immunized chickens S1 S1N S1C and SRBD were expressed in a fusion protein with GST in the pGEX 6p 1 vector induced with IPTG and blotted with immunized chicken sera Molecular standards are shown on the left TABLE 1 PRIMERS USED IN PCR AMPLIFICATION REACTIONS Name Nucleotide sequence S1p1 5H11032 ATAGGATCCAGTGGTAGTGACCTTGACCG 3H11032 S1p2 5H11032 CGCCTCGAGTTTTTGGCTAGTACTACGTAA 3H11032 SRBDp1 5H11032 CGCGGATCCAATATTACAAACTTGTGTCC 3H11032 SRBDp2 5H11032 TAACTCGAGAACCGTGGCCGGTGCATTTA 3H11032 The underlined sequences are restriction sites instructions Amersham Pharmacia Biotech Arlington Heights IL Subsequently the bound fusion protein was eluted with glutathione elution buffer 10 mM reduced glutathione 50 mM Tris HCl pH 8 0 for further analysis Enzyme linked immunosorbent assay ELISA Ninety six well microtiter plates were coated with purified fusion protein or bacterial sonicates in 0 1 M carbonate buffer IDENTIFICATION OF SARS CoV SPIKE PROTEIN EPITOPES 505 FIG 2 Expression and purification of fragments of the SARS CoV spike pro tein A Schematic diagram of relative lo cation of truncated spike protein frag ments and overlapping short peptides S1C1 TO S1C16 spanning the 510 672 aa region The numbers in parentheses in dicate the beginning and the end amino acid of each fragment S1C1 to S1C16 are a set of partially overlapping short pep tides covering the fragments of 510 672 aa of spike protein as the dashed box de fined in S1C fragment Annealed double stranded DNA fragments were cloned into the expression vector pGEX 6p 1 B Pu rification of 16 short peptide fused re combinant fusion proteins After being in duced with IPTG the supernatants of sonicates were purified by affinity chro matography The purified proteins were analyzed by 12 SDS PAGE and stained with Coomassie brilliant blue M desig nates the molecular standards as labeled on the left FIG 3 Identification of the anti genic determinants on the 510 672 aa fragment with sera from immu nized chickens A Western blot analysis of short peptide fused pro teins revealed that GST S1C7 GST S1C8 and GST S1C10 are re active with immunized chicken sera There was strong reactivity of sera with GST S1C3 and GST S1C4 and weak reactivity with GST S1C11 B ELISA analysis of fusion short peptide Microtiter plates were coated with purified re combinant fusion protein samples 2 H9262g 100 H9262l per well After block ing with skim milk chicken sera 1 200 was added followed by adding a secondary antibody AP coupled goat antichicken IgG pH 9 6 at 4 C overnight and blocked with 5 skim milk for 3 h After blocking the plates were washed three times with PBST PBS with 0 1 Tween 20 In the binding assay the plates were incubated with diluted chicken hyperimmune sera provided by the SARS group of Harbin Veterinary Re search Institute of Chinese Academy of Agricultural Sci ences at 37 C for 1 h followed by washing three times with PBST Bound antibodies were detected with an alkaline phos phatase AP conjugated rabbit antichicken IgG secondary antibody Sigma St Louis MO The reaction was stopped with 2 M NaOH and the absorbance was measured at 405 nm by a microplate auto reader Bio Rad Hercules CA In com petitive ELISA before incubation with coated microtiter plates the primary antibody was first incubated with each short peptide fused protein at 37 C for 30 min In immunized mice sera titering ELISA microtiter plates were coated with recombinant baculovirus rBac SS expressing the full length spike protein of SARS CoV Wang et al submitted The primary antibodies were diluted in immunized mice sera AP conjugated horse antimouse IgG Sigma was used as the sec ondary antibody Western blotting Cell lysates or proteins were mixed with an equal volume of sample loading buffer 50 mM Tris HCl pH 6 8 100 mM DTT 2 SDS 0 1 bromophenol blue and 10 glycerol separated by 12 SDS polyacrylamide gel electrophoresis PAGE For immunoblotting proteins were transferred from the SDS polyacrylamide gel to a nitrocellulose membrane Nonspecific antibody binding sites were blocked with 5 skim milk in PBS overnight at 4 C The membranes were in cubated with primary antibody at 37 C for 1 h After incu bation with the primary antibody the membrane was washed three times with PBST 10 min each time The blot was then probed with the appropriate secondary antibody 1 5 000 for 1 h at 37 C Secondary antibodies were AP conjugated goat antimouse IgG Sigma HRP conjugated goat antihuman IgG Beijing Zhongshang Biotechnology Co Ltd Beijing China or AP conjugated rabbit antichicken IgG Sigma Following secondary antibody incubation each blot was washed three times with PBST and then developed with either the HRP or the AP developer solution For Western blot analysis of the immunized mice sera with full length spike protein the cell lyses were separated by SDS PAGE with 10 polyacry lamide gels Immunization experiments Each of five groups of three 6 week old BALB c mice were injected with 50 H9262g of purified fusion protein S1C3 S1C4 S1C7 S1C8 or S1C10 For the first immunization the fusion protein was emulsified with an equal volume of complete Fre und s adjuvant Sigma Animals were injected at 2 week in tervals with the same immunogen mixed with incomplete Freund s adjuvant One week after the second booster im munization antiserum samples from immunized animals were collected Immunofluorescence assays Monolayers of Sf9 cells were infected with recombinant bac ulovirus rBac SS at a Moi of 2 and were incubated for 72 h at 28 C The cells were harvested by centrifugation and washed twice in PBS Glass slides were coated with infected cells air dried and fixed with acetone Immunofluorescence assays were processed with epitope specific mice sera employed as the pri mary antiserum and a FITC conjugated goat antimouse IgG Jackson IR as the secondary antibody Samples were analyzed with a Leica microscope and images were acquired with a Leica digital camera RESULTS The 510 672 aa fragment is the linear epitope dominant region in the S1 domain of the SARS CoV spike protein To identify linear antigenic epitope dominant regions within the S1 domain of the spike protein S1 12 672 aa and three truncated fragments S1N 12 510 aa S1C 318 672 aa and SRBD 318 510 aa were expressed as a fusion protein with GST in the pGEX 6p 1 vector The hyperimmune chicken sera recognized all four recombinant fusion proteins in the Western blot assay Among the four recombinant fusion proteins S1 and S1C demonstrated the strongest binding with the chicken sera whereas S1N and especially SRBD demonstrated only very weak sera binding Fig 1 From these data it is reasonable to deduce that the 510 672 aa fragment is the linear epitope dom inant region in S1 of the SARS CoV spike protein HUA ET AL 506 FIG 4 ELISA analysis of the fused short peptide with SARS convalescent sera All six fusion proteins could be recognized by SARS convalescent sera FIG 5 Competitive inhibition ELISA with overlapping epi topes The values shown represent the results from a single ex periment The experiment was repeated with similar results Mapping of antigenic epitopes on the 510 672 aa fragment of the SARS CoV spike protein To map the antigenic epitope of the 510 672 aa fragment 16 partially overlapping fragments S1C1 S1C16 were designed with lengths ranging from 16 to 21 amino acids spanning the 510 to 672 aa fragment Fig 2A All fragments were expressed in fusion with GST in the pGEX 6p 1 vector The recombinant fu sion proteins were purified with Glutathione Sepharose 4B Redi Pack column affinity chromatography according to the manu facturer s instructions Amersham Pharmacia Biotech Fig 2B ELISA and Western blot assays with immunized chicken sera were carried out for antigenicity analysis of the 16 recombinant fusion proteins The ELISA Fig 3B and Western blot Fig 3A results similarly revealed six fragments that were recognized by the chicken sera The ELISA results further demonstrated that they all could be recognized by SARS convalescent sera Fig 4 The six sera binding fragments include three pairs with overlap ping sequences The S1C3 and S1C4 pair shares a 12 aa com mon sequence while the S1C7 and S1C8 pair and the S1C10 and S1C11 pair each shares an 8 aa common sequence To in vestigate whether the antigenicity of these peptides is due to the overlapping parts of the sequences or to unique antigenic deter minants within each fragment competitive ELISA were carried out for each pair of overlapping short peptide fused proteins The results revealed the following four antigenic epitopes of the SARS CoV S1 domain S1C3 539 559 S1C4 548 567 S1C7 8 583 606 and S1C10 11 607 630 Fig 5 Immunogenicity of the four antigenic epitopes To investigate whether these four epitopes could elicit humoral immune response in mice five groups of three 6 week old BALB c mice were each injected with 50 H9262g of the purified fusion protein S1C3 S1C4 S1C7 S1C8 or S1C10 One week after the second booster immunization antiserum samples of immunized animals were collected In ELISA all five fusion proteins induced spike protein specific antibodies and the dilution titers of each exceeded 640 In the Western blot assay however only S1C4 and S1C10 induced spike protein specific antibodies Fig 6 The four antigenic epitopes are exposed on the surface of the whole spike protein expressed by baculovirus in insect cells To investigate whether the antisera from the immunized mice could recognize the full length spike protein expressed by re combinant baculovirus in insect cells we stained the recombi nant baculovirus infected Sf9 cells with these antisera and con trol nonimmunized mice sera The antisera against S1C3 S1C4 S1C8 and S1C10 all specifically bound infected Sf9 cells while the nonimmunized mice sera did not Fig 7 DISCUSSION SARS is a highly infectious and potentially lethal disease To prevent or control future outbreaks of this disease the develop IDENTIFICATION OF SARS CoV SPIKE PROTEIN EPITOPES 507 FIG 6 ELISA and Western blot analysis of epitope specific mice antisera A ELISA analysis of the reactivity of immunized mice sera to recombinant baculovirus expressed full length spike protein B Western blotting analysis of the reactivity of antis era with full length spike protein The antisera against S1C4 and S1C10 could recognize the full length denatured spike protein FIG 7 Immunofluorescence analysis of epitope specific mice antisera Immunofluorescence assay of harvested and fixed Sf9 cells infected with full length spike protein expressing recombi nant baculovirus with epitope specific mice sera as the primary antibody and a FITC conjugated goat antimouse IgG as the sec ondary antibody revealed that immunized mice sera against S1C3 A S1C4 B S1C8 C and S1C10 D all recognized infected Sf9 cells The control nonimmunized mouse sera did not recog nize the same infected Sf9 cells E and F B A 205KD 116KD 0 0 1 0 2 0 3 0 4 0 5 0 6 1 40 1 80 1 160 Sera Dilution S1C3 S1C4 S1C7 S1C8 S1C10 1 320 S1C3 S1C8 S1C4 S1C10 S1C7 Control 1 640 OD405 ment of an effective SARS vaccine is urgently needed Presently some data suggest that protective humoral immunity is achiev able Nie et al 2004 Subbarao et al 2004 ter Meulen et al 2004 Zheng et al 2004 Neutralizing antibodies could be in duced by inoculation with inactivated vaccines DNA vaccines attenuated viruses encoding SARS CoV spike protein or ex pressed spike protein Bisht et al 2004 Bukreyev et al 2004 He et al 2004 Takasuka et al 2004 Xiong et al 2004 Yang et al 2004 For humoral protective immunity the spike protein of SARS CoV is the only significant neutralization and protec tive antigen among the viral structural proteins Buchholz et al 2004 However there are serious concerns about safety and ef ficacy Marshall and Enserink 2004 A recent study demon strated that SARS CoV infection of ferrets caused mild liver in flammation and the liver damage became much more serious if the ferrets were first immunized with vaccinia virus based SARS vaccines before the virus challenge Weingartl et al 2004 In this study we identified four linear antigenic epitopes on the S1 domain of the spike protein of SARS CoV S1C3 539 559 S1C4 548 567 S1C7 8 583 606 and S1C10 11 607 630 Although S1C3 and S1C4 share a common 12 aa se quence the competitive ELISA results demonstrates that they pre sent two different epitopes S1C3 only partially inhibited the bind ing of S1C4 to chicken hyperimmune sera but significantly inhibit